ID: 1081365576

View in Genome Browser
Species Human (GRCh38)
Location 11:42231039-42231061
Sequence TGGCAATTCATTAAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081365573_1081365576 -4 Left 1081365573 11:42231020-42231042 CCAAGAAATTTCCTATTAATGGC No data
Right 1081365576 11:42231039-42231061 TGGCAATTCATTAAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081365576 Original CRISPR TGGCAATTCATTAAAGTGGC TGG Intergenic
No off target data available for this crispr