ID: 1081367787

View in Genome Browser
Species Human (GRCh38)
Location 11:42257699-42257721
Sequence CTTTCTCACAACATGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081367787_1081367791 -4 Left 1081367787 11:42257699-42257721 CCAGCCACCATGTTGTGAGAAAG No data
Right 1081367791 11:42257718-42257740 AAAGCTCAGGCCACATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081367787 Original CRISPR CTTTCTCACAACATGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr