ID: 1081368269

View in Genome Browser
Species Human (GRCh38)
Location 11:42264065-42264087
Sequence AGGCAGATTAATGCCAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081368269_1081368273 14 Left 1081368269 11:42264065-42264087 CCACAATTGGCATTAATCTGCCT No data
Right 1081368273 11:42264102-42264124 TTATCTTCAGTAACCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081368269 Original CRISPR AGGCAGATTAATGCCAATTG TGG (reversed) Intergenic
No off target data available for this crispr