ID: 1081369657

View in Genome Browser
Species Human (GRCh38)
Location 11:42284256-42284278
Sequence ATAAAGAAATTAAAATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081369657_1081369659 9 Left 1081369657 11:42284256-42284278 CCTCCAAATTTTAATTTCTTTAT No data
Right 1081369659 11:42284288-42284310 AAGCTAATAATGCCATCATTAGG No data
1081369657_1081369660 10 Left 1081369657 11:42284256-42284278 CCTCCAAATTTTAATTTCTTTAT No data
Right 1081369660 11:42284289-42284311 AGCTAATAATGCCATCATTAGGG No data
1081369657_1081369661 11 Left 1081369657 11:42284256-42284278 CCTCCAAATTTTAATTTCTTTAT No data
Right 1081369661 11:42284290-42284312 GCTAATAATGCCATCATTAGGGG No data
1081369657_1081369663 21 Left 1081369657 11:42284256-42284278 CCTCCAAATTTTAATTTCTTTAT No data
Right 1081369663 11:42284300-42284322 CCATCATTAGGGGTGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081369657 Original CRISPR ATAAAGAAATTAAAATTTGG AGG (reversed) Intergenic
No off target data available for this crispr