ID: 1081369658

View in Genome Browser
Species Human (GRCh38)
Location 11:42284259-42284281
Sequence CAGATAAAGAAATTAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081369658_1081369659 6 Left 1081369658 11:42284259-42284281 CCAAATTTTAATTTCTTTATCTG No data
Right 1081369659 11:42284288-42284310 AAGCTAATAATGCCATCATTAGG No data
1081369658_1081369661 8 Left 1081369658 11:42284259-42284281 CCAAATTTTAATTTCTTTATCTG No data
Right 1081369661 11:42284290-42284312 GCTAATAATGCCATCATTAGGGG No data
1081369658_1081369660 7 Left 1081369658 11:42284259-42284281 CCAAATTTTAATTTCTTTATCTG No data
Right 1081369660 11:42284289-42284311 AGCTAATAATGCCATCATTAGGG No data
1081369658_1081369663 18 Left 1081369658 11:42284259-42284281 CCAAATTTTAATTTCTTTATCTG No data
Right 1081369663 11:42284300-42284322 CCATCATTAGGGGTGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081369658 Original CRISPR CAGATAAAGAAATTAAAATT TGG (reversed) Intergenic
No off target data available for this crispr