ID: 1081369661

View in Genome Browser
Species Human (GRCh38)
Location 11:42284290-42284312
Sequence GCTAATAATGCCATCATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081369657_1081369661 11 Left 1081369657 11:42284256-42284278 CCTCCAAATTTTAATTTCTTTAT No data
Right 1081369661 11:42284290-42284312 GCTAATAATGCCATCATTAGGGG No data
1081369658_1081369661 8 Left 1081369658 11:42284259-42284281 CCAAATTTTAATTTCTTTATCTG No data
Right 1081369661 11:42284290-42284312 GCTAATAATGCCATCATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081369661 Original CRISPR GCTAATAATGCCATCATTAG GGG Intergenic
No off target data available for this crispr