ID: 1081380614

View in Genome Browser
Species Human (GRCh38)
Location 11:42410064-42410086
Sequence AGGTTGTTTTAATTGCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081380613_1081380614 -5 Left 1081380613 11:42410046-42410068 CCATAGTAAATGTTCAACAGGTT No data
Right 1081380614 11:42410064-42410086 AGGTTGTTTTAATTGCTACCTGG No data
1081380610_1081380614 0 Left 1081380610 11:42410041-42410063 CCAGCCCATAGTAAATGTTCAAC No data
Right 1081380614 11:42410064-42410086 AGGTTGTTTTAATTGCTACCTGG No data
1081380612_1081380614 -4 Left 1081380612 11:42410045-42410067 CCCATAGTAAATGTTCAACAGGT No data
Right 1081380614 11:42410064-42410086 AGGTTGTTTTAATTGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081380614 Original CRISPR AGGTTGTTTTAATTGCTACC TGG Intergenic
No off target data available for this crispr