ID: 1081381476

View in Genome Browser
Species Human (GRCh38)
Location 11:42421574-42421596
Sequence TCTTCCATGCTGATGTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081381476_1081381479 27 Left 1081381476 11:42421574-42421596 CCTTGAAACATCAGCATGGAAGA No data
Right 1081381479 11:42421624-42421646 AGAGATTAAAAAGAGGTTCACGG No data
1081381476_1081381477 -4 Left 1081381476 11:42421574-42421596 CCTTGAAACATCAGCATGGAAGA No data
Right 1081381477 11:42421593-42421615 AAGAAGTGAAATGTAAAGAGAGG No data
1081381476_1081381478 20 Left 1081381476 11:42421574-42421596 CCTTGAAACATCAGCATGGAAGA No data
Right 1081381478 11:42421617-42421639 AGAAAAGAGAGATTAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081381476 Original CRISPR TCTTCCATGCTGATGTTTCA AGG (reversed) Intergenic
No off target data available for this crispr