ID: 1081383727

View in Genome Browser
Species Human (GRCh38)
Location 11:42446502-42446524
Sequence TGCTGTCACTGTGCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081383727_1081383730 -8 Left 1081383727 11:42446502-42446524 CCCTGAGATGCACAGTGACAGCA No data
Right 1081383730 11:42446517-42446539 TGACAGCAGGCAACATGCTAAGG No data
1081383727_1081383732 -1 Left 1081383727 11:42446502-42446524 CCCTGAGATGCACAGTGACAGCA No data
Right 1081383732 11:42446524-42446546 AGGCAACATGCTAAGGCCATGGG No data
1081383727_1081383731 -2 Left 1081383727 11:42446502-42446524 CCCTGAGATGCACAGTGACAGCA No data
Right 1081383731 11:42446523-42446545 CAGGCAACATGCTAAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081383727 Original CRISPR TGCTGTCACTGTGCATCTCA GGG (reversed) Intergenic
No off target data available for this crispr