ID: 1081383731

View in Genome Browser
Species Human (GRCh38)
Location 11:42446523-42446545
Sequence CAGGCAACATGCTAAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081383728_1081383731 -3 Left 1081383728 11:42446503-42446525 CCTGAGATGCACAGTGACAGCAG No data
Right 1081383731 11:42446523-42446545 CAGGCAACATGCTAAGGCCATGG No data
1081383727_1081383731 -2 Left 1081383727 11:42446502-42446524 CCCTGAGATGCACAGTGACAGCA No data
Right 1081383731 11:42446523-42446545 CAGGCAACATGCTAAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081383731 Original CRISPR CAGGCAACATGCTAAGGCCA TGG Intergenic
No off target data available for this crispr