ID: 1081397092

View in Genome Browser
Species Human (GRCh38)
Location 11:42599070-42599092
Sequence CATTATCAGGATAATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081397083_1081397092 29 Left 1081397083 11:42599018-42599040 CCACGTGAAACTTTCGGAAATGC No data
Right 1081397092 11:42599070-42599092 CATTATCAGGATAATGGGGCAGG No data
1081397085_1081397092 0 Left 1081397085 11:42599047-42599069 CCTGATGTAAAAATAAATACCTC No data
Right 1081397092 11:42599070-42599092 CATTATCAGGATAATGGGGCAGG No data
1081397084_1081397092 7 Left 1081397084 11:42599040-42599062 CCGAGTTCCTGATGTAAAAATAA No data
Right 1081397092 11:42599070-42599092 CATTATCAGGATAATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081397092 Original CRISPR CATTATCAGGATAATGGGGC AGG Intergenic
No off target data available for this crispr