ID: 1081399611

View in Genome Browser
Species Human (GRCh38)
Location 11:42627443-42627465
Sequence TAGGTCCCCAAAGATGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081399609_1081399611 -3 Left 1081399609 11:42627423-42627445 CCATGTGGTAGGCAAAATAATAG No data
Right 1081399611 11:42627443-42627465 TAGGTCCCCAAAGATGTTCATGG No data
1081399606_1081399611 24 Left 1081399606 11:42627396-42627418 CCAACAAGGGGAGGTAAAATTAT No data
Right 1081399611 11:42627443-42627465 TAGGTCCCCAAAGATGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081399611 Original CRISPR TAGGTCCCCAAAGATGTTCA TGG Intergenic
No off target data available for this crispr