ID: 1081400394

View in Genome Browser
Species Human (GRCh38)
Location 11:42636172-42636194
Sequence CTCCAGTAGGGACACCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081400394_1081400400 6 Left 1081400394 11:42636172-42636194 CCCACACGGTGTCCCTACTGGAG No data
Right 1081400400 11:42636201-42636223 CTAGTAGAGCTGTGAGAAGAGGG 0: 105
1: 1869
2: 2049
3: 1292
4: 943
1081400394_1081400399 5 Left 1081400394 11:42636172-42636194 CCCACACGGTGTCCCTACTGGAG No data
Right 1081400399 11:42636200-42636222 CCTAGTAGAGCTGTGAGAAGAGG 0: 101
1: 1789
2: 2058
3: 1403
4: 869

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081400394 Original CRISPR CTCCAGTAGGGACACCGTGT GGG (reversed) Intergenic
No off target data available for this crispr