ID: 1081401361

View in Genome Browser
Species Human (GRCh38)
Location 11:42646941-42646963
Sequence TAGTGGCTCATTAAACTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081401361_1081401365 -9 Left 1081401361 11:42646941-42646963 CCCTAGAGTTTAATGAGCCACTA No data
Right 1081401365 11:42646955-42646977 GAGCCACTAAACACCTGGGCTGG No data
1081401361_1081401368 6 Left 1081401361 11:42646941-42646963 CCCTAGAGTTTAATGAGCCACTA No data
Right 1081401368 11:42646970-42646992 TGGGCTGGCACTAATATTCATGG No data
1081401361_1081401369 27 Left 1081401361 11:42646941-42646963 CCCTAGAGTTTAATGAGCCACTA No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081401361 Original CRISPR TAGTGGCTCATTAAACTCTA GGG (reversed) Intergenic
No off target data available for this crispr