ID: 1081401366

View in Genome Browser
Species Human (GRCh38)
Location 11:42646958-42646980
Sequence GTGCCAGCCCAGGTGTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081401366_1081401369 10 Left 1081401366 11:42646958-42646980 CCACTAAACACCTGGGCTGGCAC No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081401366 Original CRISPR GTGCCAGCCCAGGTGTTTAG TGG (reversed) Intergenic
No off target data available for this crispr