ID: 1081401367

View in Genome Browser
Species Human (GRCh38)
Location 11:42646968-42646990
Sequence ATGAATATTAGTGCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081401367_1081401369 0 Left 1081401367 11:42646968-42646990 CCTGGGCTGGCACTAATATTCAT No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081401367 Original CRISPR ATGAATATTAGTGCCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr