ID: 1081401369

View in Genome Browser
Species Human (GRCh38)
Location 11:42646991-42647013
Sequence GGCTATAGCAAAACACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081401366_1081401369 10 Left 1081401366 11:42646958-42646980 CCACTAAACACCTGGGCTGGCAC No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data
1081401361_1081401369 27 Left 1081401361 11:42646941-42646963 CCCTAGAGTTTAATGAGCCACTA No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data
1081401360_1081401369 28 Left 1081401360 11:42646940-42646962 CCCCTAGAGTTTAATGAGCCACT No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data
1081401367_1081401369 0 Left 1081401367 11:42646968-42646990 CCTGGGCTGGCACTAATATTCAT No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data
1081401362_1081401369 26 Left 1081401362 11:42646942-42646964 CCTAGAGTTTAATGAGCCACTAA No data
Right 1081401369 11:42646991-42647013 GGCTATAGCAAAACACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081401369 Original CRISPR GGCTATAGCAAAACACACCC AGG Intergenic
No off target data available for this crispr