ID: 1081403077

View in Genome Browser
Species Human (GRCh38)
Location 11:42665338-42665360
Sequence AAGGAGGCTCTCTTCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081403077_1081403083 30 Left 1081403077 11:42665338-42665360 CCTCATCTGAAGAGAGCCTCCTT No data
Right 1081403083 11:42665391-42665413 CAGCAGATGCAGACATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081403077 Original CRISPR AAGGAGGCTCTCTTCAGATG AGG (reversed) Intergenic
No off target data available for this crispr