ID: 1081405380

View in Genome Browser
Species Human (GRCh38)
Location 11:42691771-42691793
Sequence TAGGGTTCTTGATGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081405380_1081405388 17 Left 1081405380 11:42691771-42691793 CCAGCAGCACATCAAGAACCCTA No data
Right 1081405388 11:42691811-42691833 GGCTTCATCCCTGGGATGCAAGG 0: 8412
1: 4364
2: 2744
3: 2707
4: 3046
1081405380_1081405386 8 Left 1081405380 11:42691771-42691793 CCAGCAGCACATCAAGAACCCTA No data
Right 1081405386 11:42691802-42691824 GATCAAGTTGGCTTCATCCCTGG 0: 949
1: 8621
2: 4200
3: 3299
4: 3570
1081405380_1081405387 9 Left 1081405380 11:42691771-42691793 CCAGCAGCACATCAAGAACCCTA No data
Right 1081405387 11:42691803-42691825 ATCAAGTTGGCTTCATCCCTGGG 0: 1222
1: 8780
2: 4291
3: 2572
4: 2900
1081405380_1081405383 -4 Left 1081405380 11:42691771-42691793 CCAGCAGCACATCAAGAACCCTA No data
Right 1081405383 11:42691790-42691812 CCTATCCACCATGATCAAGTTGG 0: 34
1: 7418
2: 3917
3: 3173
4: 2948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081405380 Original CRISPR TAGGGTTCTTGATGTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr