ID: 1081407401

View in Genome Browser
Species Human (GRCh38)
Location 11:42714010-42714032
Sequence TTGGATGCACATCTATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081407401_1081407407 21 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407407 11:42714054-42714076 GGGGGAATTGAACTATTGTAAGG No data
1081407401_1081407406 3 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407406 11:42714036-42714058 TCTGAGTATGAATTTGAAGGGGG No data
1081407401_1081407405 2 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407405 11:42714035-42714057 GTCTGAGTATGAATTTGAAGGGG No data
1081407401_1081407403 0 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407403 11:42714033-42714055 AAGTCTGAGTATGAATTTGAAGG No data
1081407401_1081407404 1 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407404 11:42714034-42714056 AGTCTGAGTATGAATTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081407401 Original CRISPR TTGGATGCACATCTATTGCA TGG (reversed) Intergenic
No off target data available for this crispr