ID: 1081407403

View in Genome Browser
Species Human (GRCh38)
Location 11:42714033-42714055
Sequence AAGTCTGAGTATGAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081407401_1081407403 0 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407403 11:42714033-42714055 AAGTCTGAGTATGAATTTGAAGG No data
1081407400_1081407403 7 Left 1081407400 11:42714003-42714025 CCACACACCATGCAATAGATGTG No data
Right 1081407403 11:42714033-42714055 AAGTCTGAGTATGAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081407403 Original CRISPR AAGTCTGAGTATGAATTTGA AGG Intergenic
No off target data available for this crispr