ID: 1081407405 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:42714035-42714057 |
| Sequence | GTCTGAGTATGAATTTGAAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1081407401_1081407405 | 2 | Left | 1081407401 | 11:42714010-42714032 | CCATGCAATAGATGTGCATCCAA | No data | ||
| Right | 1081407405 | 11:42714035-42714057 | GTCTGAGTATGAATTTGAAGGGG | No data | ||||
| 1081407400_1081407405 | 9 | Left | 1081407400 | 11:42714003-42714025 | CCACACACCATGCAATAGATGTG | No data | ||
| Right | 1081407405 | 11:42714035-42714057 | GTCTGAGTATGAATTTGAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1081407405 | Original CRISPR | GTCTGAGTATGAATTTGAAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||