ID: 1081407407

View in Genome Browser
Species Human (GRCh38)
Location 11:42714054-42714076
Sequence GGGGGAATTGAACTATTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081407400_1081407407 28 Left 1081407400 11:42714003-42714025 CCACACACCATGCAATAGATGTG No data
Right 1081407407 11:42714054-42714076 GGGGGAATTGAACTATTGTAAGG No data
1081407402_1081407407 2 Left 1081407402 11:42714029-42714051 CCAAAAGTCTGAGTATGAATTTG No data
Right 1081407407 11:42714054-42714076 GGGGGAATTGAACTATTGTAAGG No data
1081407401_1081407407 21 Left 1081407401 11:42714010-42714032 CCATGCAATAGATGTGCATCCAA No data
Right 1081407407 11:42714054-42714076 GGGGGAATTGAACTATTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081407407 Original CRISPR GGGGGAATTGAACTATTGTA AGG Intergenic
No off target data available for this crispr