ID: 1081416145

View in Genome Browser
Species Human (GRCh38)
Location 11:42818477-42818499
Sequence TTCACTTAAGCTAACTCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081416145_1081416148 24 Left 1081416145 11:42818477-42818499 CCATTCGAGTTAGCTTAAGTGAA No data
Right 1081416148 11:42818524-42818546 AGTACCCTATAGACCACACCGGG No data
1081416145_1081416151 28 Left 1081416145 11:42818477-42818499 CCATTCGAGTTAGCTTAAGTGAA No data
Right 1081416151 11:42818528-42818550 CCCTATAGACCACACCGGGGTGG No data
1081416145_1081416146 -6 Left 1081416145 11:42818477-42818499 CCATTCGAGTTAGCTTAAGTGAA No data
Right 1081416146 11:42818494-42818516 AGTGAAGAGAAACTCTTTTTAGG No data
1081416145_1081416147 23 Left 1081416145 11:42818477-42818499 CCATTCGAGTTAGCTTAAGTGAA No data
Right 1081416147 11:42818523-42818545 CAGTACCCTATAGACCACACCGG No data
1081416145_1081416149 25 Left 1081416145 11:42818477-42818499 CCATTCGAGTTAGCTTAAGTGAA No data
Right 1081416149 11:42818525-42818547 GTACCCTATAGACCACACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081416145 Original CRISPR TTCACTTAAGCTAACTCGAA TGG (reversed) Intergenic
No off target data available for this crispr