ID: 1081416149

View in Genome Browser
Species Human (GRCh38)
Location 11:42818525-42818547
Sequence GTACCCTATAGACCACACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081416145_1081416149 25 Left 1081416145 11:42818477-42818499 CCATTCGAGTTAGCTTAAGTGAA No data
Right 1081416149 11:42818525-42818547 GTACCCTATAGACCACACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081416149 Original CRISPR GTACCCTATAGACCACACCG GGG Intergenic
No off target data available for this crispr