ID: 1081417453

View in Genome Browser
Species Human (GRCh38)
Location 11:42833242-42833264
Sequence CAGAATAAGAAATTGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081417451_1081417453 -6 Left 1081417451 11:42833225-42833247 CCTCTCTTTCCTTCTAACAGAAT No data
Right 1081417453 11:42833242-42833264 CAGAATAAGAAATTGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081417453 Original CRISPR CAGAATAAGAAATTGTATTC TGG Intergenic
No off target data available for this crispr