ID: 1081419065

View in Genome Browser
Species Human (GRCh38)
Location 11:42850835-42850857
Sequence GAGTGAAGACTTCTAACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081419062_1081419065 6 Left 1081419062 11:42850806-42850828 CCAAAAATAGTATTCATCCACAC No data
Right 1081419065 11:42850835-42850857 GAGTGAAGACTTCTAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081419065 Original CRISPR GAGTGAAGACTTCTAACATA TGG Intergenic
No off target data available for this crispr