ID: 1081426369

View in Genome Browser
Species Human (GRCh38)
Location 11:42930536-42930558
Sequence TTTGATGCCCAGAAGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081426364_1081426369 -10 Left 1081426364 11:42930523-42930545 CCTCACTTGCAGTTTTGATGCCC No data
Right 1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG No data
1081426363_1081426369 26 Left 1081426363 11:42930487-42930509 CCTTTTGTCTTTTTTTTTCTCTC No data
Right 1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081426369 Original CRISPR TTTGATGCCCAGAAGGGAAG GGG Intergenic
No off target data available for this crispr