ID: 1081426369 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:42930536-42930558 |
| Sequence | TTTGATGCCCAGAAGGGAAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1081426364_1081426369 | -10 | Left | 1081426364 | 11:42930523-42930545 | CCTCACTTGCAGTTTTGATGCCC | No data | ||
| Right | 1081426369 | 11:42930536-42930558 | TTTGATGCCCAGAAGGGAAGGGG | No data | ||||
| 1081426363_1081426369 | 26 | Left | 1081426363 | 11:42930487-42930509 | CCTTTTGTCTTTTTTTTTCTCTC | No data | ||
| Right | 1081426369 | 11:42930536-42930558 | TTTGATGCCCAGAAGGGAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1081426369 | Original CRISPR | TTTGATGCCCAGAAGGGAAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||