ID: 1081428290

View in Genome Browser
Species Human (GRCh38)
Location 11:42949603-42949625
Sequence TAGGATACCCAATCAGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081428290_1081428295 26 Left 1081428290 11:42949603-42949625 CCATGACCTGATTGGGTATCCTA No data
Right 1081428295 11:42949652-42949674 TTTTGACTAGACACCTGTGGTGG No data
1081428290_1081428294 23 Left 1081428290 11:42949603-42949625 CCATGACCTGATTGGGTATCCTA No data
Right 1081428294 11:42949649-42949671 CCGTTTTGACTAGACACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081428290 Original CRISPR TAGGATACCCAATCAGGTCA TGG (reversed) Intergenic
No off target data available for this crispr