ID: 1081435675

View in Genome Browser
Species Human (GRCh38)
Location 11:43024912-43024934
Sequence CAGAGCCACAACTCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081435675_1081435677 3 Left 1081435675 11:43024912-43024934 CCTGGGTGTGAGTTGTGGCTCTG No data
Right 1081435677 11:43024938-43024960 CTTATGAGATGTGTGACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081435675 Original CRISPR CAGAGCCACAACTCACACCC AGG (reversed) Intergenic
No off target data available for this crispr