ID: 1081438940

View in Genome Browser
Species Human (GRCh38)
Location 11:43058857-43058879
Sequence AATTGTGCCTGGAGCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081438935_1081438940 11 Left 1081438935 11:43058823-43058845 CCAAATATTTCATCACTGAATTC No data
Right 1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG No data
1081438934_1081438940 22 Left 1081438934 11:43058812-43058834 CCTGGCTCAAGCCAAATATTTCA No data
Right 1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081438940 Original CRISPR AATTGTGCCTGGAGCACAGT GGG Intergenic
No off target data available for this crispr