ID: 1081441216

View in Genome Browser
Species Human (GRCh38)
Location 11:43083478-43083500
Sequence TAGGCTACTAACCATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081441216_1081441219 11 Left 1081441216 11:43083478-43083500 CCAGCAACATGGTTAGTAGCCTA No data
Right 1081441219 11:43083512-43083534 CACTTTTTTCATATACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081441216 Original CRISPR TAGGCTACTAACCATGTTGC TGG (reversed) Intergenic
No off target data available for this crispr