ID: 1081447255

View in Genome Browser
Species Human (GRCh38)
Location 11:43142591-43142613
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081447249_1081447255 21 Left 1081447249 11:43142547-43142569 CCTGAGAATAGAAAAAGAATCAT No data
Right 1081447255 11:43142591-43142613 GAGGATTCCCAGTGCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081447255 Original CRISPR GAGGATTCCCAGTGCTCACA GGG Intergenic
No off target data available for this crispr