ID: 1081447601

View in Genome Browser
Species Human (GRCh38)
Location 11:43145683-43145705
Sequence AATGGGGCCCAGAAATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081447601_1081447607 -6 Left 1081447601 11:43145683-43145705 CCCTGACATTTCTGGGCCCCATT No data
Right 1081447607 11:43145700-43145722 CCCATTGTGAAAGGGACGCTTGG No data
1081447601_1081447610 16 Left 1081447601 11:43145683-43145705 CCCTGACATTTCTGGGCCCCATT No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data
1081447601_1081447612 28 Left 1081447601 11:43145683-43145705 CCCTGACATTTCTGGGCCCCATT No data
Right 1081447612 11:43145734-43145756 CCAGTGCATGGACTGCTTAGAGG No data
1081447601_1081447609 -1 Left 1081447601 11:43145683-43145705 CCCTGACATTTCTGGGCCCCATT No data
Right 1081447609 11:43145705-43145727 TGTGAAAGGGACGCTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081447601 Original CRISPR AATGGGGCCCAGAAATGTCA GGG (reversed) Intergenic
No off target data available for this crispr