ID: 1081447607

View in Genome Browser
Species Human (GRCh38)
Location 11:43145700-43145722
Sequence CCCATTGTGAAAGGGACGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081447601_1081447607 -6 Left 1081447601 11:43145683-43145705 CCCTGACATTTCTGGGCCCCATT No data
Right 1081447607 11:43145700-43145722 CCCATTGTGAAAGGGACGCTTGG No data
1081447600_1081447607 -5 Left 1081447600 11:43145682-43145704 CCCCTGACATTTCTGGGCCCCAT No data
Right 1081447607 11:43145700-43145722 CCCATTGTGAAAGGGACGCTTGG No data
1081447602_1081447607 -7 Left 1081447602 11:43145684-43145706 CCTGACATTTCTGGGCCCCATTG No data
Right 1081447607 11:43145700-43145722 CCCATTGTGAAAGGGACGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081447607 Original CRISPR CCCATTGTGAAAGGGACGCT TGG Intergenic
No off target data available for this crispr