ID: 1081447610

View in Genome Browser
Species Human (GRCh38)
Location 11:43145722-43145744
Sequence GAGAGGATGAAGCCAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081447600_1081447610 17 Left 1081447600 11:43145682-43145704 CCCCTGACATTTCTGGGCCCCAT No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data
1081447601_1081447610 16 Left 1081447601 11:43145683-43145705 CCCTGACATTTCTGGGCCCCATT No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data
1081447605_1081447610 0 Left 1081447605 11:43145699-43145721 CCCCATTGTGAAAGGGACGCTTG No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data
1081447608_1081447610 -2 Left 1081447608 11:43145701-43145723 CCATTGTGAAAGGGACGCTTGGA No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data
1081447602_1081447610 15 Left 1081447602 11:43145684-43145706 CCTGACATTTCTGGGCCCCATTG No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data
1081447606_1081447610 -1 Left 1081447606 11:43145700-43145722 CCCATTGTGAAAGGGACGCTTGG No data
Right 1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081447610 Original CRISPR GAGAGGATGAAGCCAGTGCA TGG Intergenic
No off target data available for this crispr