ID: 1081449226

View in Genome Browser
Species Human (GRCh38)
Location 11:43156450-43156472
Sequence GTGTACACCCACTGCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081449226_1081449231 9 Left 1081449226 11:43156450-43156472 CCAATATAGCAGTGGGTGTACAC No data
Right 1081449231 11:43156482-43156504 GATAATTCTGCAAATATTCAGGG No data
1081449226_1081449230 8 Left 1081449226 11:43156450-43156472 CCAATATAGCAGTGGGTGTACAC No data
Right 1081449230 11:43156481-43156503 TGATAATTCTGCAAATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081449226 Original CRISPR GTGTACACCCACTGCTATAT TGG (reversed) Intergenic
No off target data available for this crispr