ID: 1081451149

View in Genome Browser
Species Human (GRCh38)
Location 11:43171946-43171968
Sequence ACACCATGCCCAATATCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081451145_1081451149 3 Left 1081451145 11:43171920-43171942 CCCAATATCCAGGGAAAGAGGGG No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451136_1081451149 21 Left 1081451136 11:43171902-43171924 CCCCCCTGGGATATTGTTCCCAA No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451148_1081451149 -5 Left 1081451148 11:43171928-43171950 CCAGGGAAAGAGGGGATAACACC No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451137_1081451149 20 Left 1081451137 11:43171903-43171925 CCCCCTGGGATATTGTTCCCAAT No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451140_1081451149 17 Left 1081451140 11:43171906-43171928 CCTGGGATATTGTTCCCAATATC No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451139_1081451149 18 Left 1081451139 11:43171905-43171927 CCCTGGGATATTGTTCCCAATAT No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451147_1081451149 2 Left 1081451147 11:43171921-43171943 CCAATATCCAGGGAAAGAGGGGA No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451138_1081451149 19 Left 1081451138 11:43171904-43171926 CCCCTGGGATATTGTTCCCAATA No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451134_1081451149 23 Left 1081451134 11:43171900-43171922 CCCCCCCCTGGGATATTGTTCCC No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data
1081451135_1081451149 22 Left 1081451135 11:43171901-43171923 CCCCCCCTGGGATATTGTTCCCA No data
Right 1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081451149 Original CRISPR ACACCATGCCCAATATCGCA AGG Intergenic
No off target data available for this crispr