ID: 1081454989

View in Genome Browser
Species Human (GRCh38)
Location 11:43212578-43212600
Sequence TACCGAACTCGGGAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081454989_1081454998 3 Left 1081454989 11:43212578-43212600 CCCCTCCCCTCCCGAGTTCGGTA No data
Right 1081454998 11:43212604-43212626 TTGAGCAGATTCCAGCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081454989 Original CRISPR TACCGAACTCGGGAGGGGAG GGG (reversed) Intergenic
No off target data available for this crispr