ID: 1081461685

View in Genome Browser
Species Human (GRCh38)
Location 11:43278310-43278332
Sequence CTGGCTACACAATTCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081461677_1081461685 16 Left 1081461677 11:43278271-43278293 CCCTCTGAGATCCTGGAGGCCAG No data
Right 1081461685 11:43278310-43278332 CTGGCTACACAATTCACCCAGGG No data
1081461678_1081461685 15 Left 1081461678 11:43278272-43278294 CCTCTGAGATCCTGGAGGCCAGG No data
Right 1081461685 11:43278310-43278332 CTGGCTACACAATTCACCCAGGG No data
1081461680_1081461685 5 Left 1081461680 11:43278282-43278304 CCTGGAGGCCAGGACTTCTCAAA No data
Right 1081461685 11:43278310-43278332 CTGGCTACACAATTCACCCAGGG No data
1081461681_1081461685 -3 Left 1081461681 11:43278290-43278312 CCAGGACTTCTCAAACTTTCCTG No data
Right 1081461685 11:43278310-43278332 CTGGCTACACAATTCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081461685 Original CRISPR CTGGCTACACAATTCACCCA GGG Intergenic
No off target data available for this crispr