ID: 1081465332

View in Genome Browser
Species Human (GRCh38)
Location 11:43311722-43311744
Sequence TCATATGTAAGATCTTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081465325_1081465332 26 Left 1081465325 11:43311673-43311695 CCGATTAATATTACCTTCCTTGA No data
Right 1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG No data
1081465329_1081465332 9 Left 1081465329 11:43311690-43311712 CCTTGAATCAGGAGGAAACCATT No data
Right 1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG No data
1081465328_1081465332 13 Left 1081465328 11:43311686-43311708 CCTTCCTTGAATCAGGAGGAAAC No data
Right 1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG No data
1081465324_1081465332 29 Left 1081465324 11:43311670-43311692 CCACCGATTAATATTACCTTCCT No data
Right 1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG No data
1081465330_1081465332 -9 Left 1081465330 11:43311708-43311730 CCATTTGTGACTTCTCATATGTA No data
Right 1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081465332 Original CRISPR TCATATGTAAGATCTTCTAA GGG Intergenic
No off target data available for this crispr