ID: 1081466736

View in Genome Browser
Species Human (GRCh38)
Location 11:43326225-43326247
Sequence CAAGGTCAAGACACTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081466736 Original CRISPR CAAGGTCAAGACACTTTTGC AGG (reversed) Intronic
900772891 1:4559746-4559768 CAAGGACAGGACAGTTTTGACGG + Intergenic
901306206 1:8234846-8234868 CAAGGTGAAGACAGTGTTGATGG + Intergenic
906782036 1:48581111-48581133 CAAGATGAAGACAGTTTTGAGGG - Intronic
910078985 1:83316570-83316592 CAGGGTCAAAACAGTTTTTCTGG - Intergenic
910417684 1:87017905-87017927 CATATTCAAGACACTTTTGTGGG - Intronic
916164606 1:161954686-161954708 CAATGTCCAGACACTTTTTCTGG + Intronic
920707179 1:208261343-208261365 CAAGTTTAATACACTTTTGTTGG + Intergenic
920923720 1:210321797-210321819 CAACGTTCAGACACTTCTGCCGG + Intergenic
921063744 1:211608244-211608266 CAAAGTCCAAACACTTTGGCTGG + Intergenic
924487681 1:244502637-244502659 CCAGGTTAAGACACTTTCGAAGG - Intronic
924805656 1:247359451-247359473 TAAAGTCAGGACACTTCTGCTGG + Intergenic
1063505629 10:6595785-6595807 TAAGGTCAAAATTCTTTTGCTGG + Intergenic
1064387610 10:14911194-14911216 CCAGGACAAGACACTGTTCCTGG - Intronic
1065588550 10:27242307-27242329 CAATCTCAAGACACTTAAGCTGG - Intergenic
1065740087 10:28789722-28789744 CAAGGGCAAGATATTTTAGCTGG + Intergenic
1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG + Intergenic
1072850535 10:98886297-98886319 TAAGGTAAAAACACCTTTGCTGG + Intronic
1072913669 10:99523967-99523989 CATGGTCAAGAGACTTCTACTGG - Intergenic
1072989945 10:100183207-100183229 CATGGCCAAGACACTTTTCGAGG + Intronic
1073255284 10:102146981-102147003 CAAGGACAAGACAGGTTTGATGG - Exonic
1074944508 10:118268309-118268331 CAAAGACATGACACTTTTCCAGG - Intergenic
1076712880 10:132348335-132348357 CAAAGCCAAGACACGTTTTCAGG + Exonic
1081466736 11:43326225-43326247 CAAGGTCAAGACACTTTTGCAGG - Intronic
1087820439 11:102705505-102705527 AAAGTTCAGGACTCTTTTGCAGG + Intronic
1087909433 11:103736170-103736192 TAAGGGCAAGACACTTTGCCTGG - Intergenic
1091019022 11:132082100-132082122 CAAGGTTAAAACACTTTTGTAGG + Intronic
1091560815 12:1611602-1611624 CAAGGATGAGACCCTTTTGCAGG + Intronic
1095624213 12:44296054-44296076 CTGGGTCACGAGACTTTTGCTGG + Intronic
1098316824 12:69201818-69201840 CAAAGTCCTGACACTTTTTCTGG - Intergenic
1100765689 12:97862995-97863017 CAAGGTCCAGACAGCTATGCTGG - Intergenic
1101411894 12:104475835-104475857 GAAGGTCAAGAGATTTTTCCTGG + Intronic
1102568960 12:113815719-113815741 TAAGCTCAACACACATTTGCTGG + Intergenic
1106107677 13:26747894-26747916 CAAGGGCCACACACTTTGGCAGG + Intergenic
1106172333 13:27298641-27298663 CAATGCCAACTCACTTTTGCCGG + Intergenic
1107327180 13:39257265-39257287 CAAGGTCAAATCCCTTTTCCAGG - Intergenic
1107922749 13:45227208-45227230 AAATGTCAACATACTTTTGCAGG - Intronic
1109773722 13:67011774-67011796 CAAGACCAAAACATTTTTGCAGG - Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1115823065 14:37233457-37233479 CAAGTTCAGGACACTTTTGTTGG + Intronic
1117637217 14:57756029-57756051 CATGGTCAGGGAACTTTTGCAGG + Intronic
1117725013 14:58664493-58664515 GTAGGTCTACACACTTTTGCTGG - Intergenic
1119758135 14:77133089-77133111 CAGGTTCAAGACCCTTTTTCTGG - Exonic
1120345612 14:83285754-83285776 CCAGTTCAAGACACTTTTGTAGG - Intergenic
1122095078 14:99364522-99364544 CAAGGTTAAGTGACTTATGCAGG - Intergenic
1123197503 14:106630617-106630639 CAAGGTCAACACACTCTTTGTGG - Intergenic
1123198847 14:106642546-106642568 CAAGGTCAACACACTCTTTGTGG - Intergenic
1125513845 15:40307206-40307228 CAAGGGCAAGACATCTGTGCTGG + Intronic
1126311683 15:47324341-47324363 ACAGGTCAAGCCATTTTTGCTGG - Intronic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1129129955 15:73484727-73484749 CTAGGTAAAGACACTCATGCTGG - Intronic
1129310169 15:74701983-74702005 CAATGTTAACACACTATTGCTGG - Intergenic
1130388794 15:83436523-83436545 CAAGGTGATGACAGTGTTGCTGG - Intergenic
1131158697 15:90090599-90090621 CGAGGTCAAAATACTTTAGCTGG + Exonic
1131430171 15:92381012-92381034 GAAGGTCAAGACAATTTTGTAGG + Intergenic
1132973306 16:2699388-2699410 CAAGTTCAAGAGCCTTTTTCTGG + Intronic
1133336404 16:5009345-5009367 CATGATCAGGAAACTTTTGCGGG + Intronic
1136023944 16:27458003-27458025 CAAGGTCAAGACACTTTGGTGGG + Intergenic
1137894350 16:52194998-52195020 GAAGGGCAAGCCACTTTTACTGG + Intergenic
1139295740 16:65899030-65899052 CAAGATCAAAGCACTTTTGAGGG - Intergenic
1143164628 17:4891713-4891735 CAAGGTAAGGACAGTTCTGCAGG + Exonic
1150240100 17:63623893-63623915 CAAGGTCAAGTCCTTTTTGTAGG + Intronic
1150616037 17:66772570-66772592 CAAGGTCAAGACACACTAACAGG - Intronic
1150742804 17:67793006-67793028 CAAGTTCAAGACACTTTTGTAGG - Intergenic
1150849228 17:68688629-68688651 CAAGGTAAATACAGCTTTGCAGG - Intergenic
1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG + Intronic
1153322671 18:3788611-3788633 CAAGGTCATTACACGTTGGCAGG + Intronic
1157602160 18:48900858-48900880 CAAGGTCAAGTTACTTGTCCAGG + Intergenic
1159056326 18:63468388-63468410 CAAGTTCAAGACACTTTTGTAGG - Intergenic
1159722602 18:71911340-71911362 CAAAGTGAAGACATTTTGGCTGG + Intergenic
1159727888 18:71985355-71985377 CAAGGTCAAGACCCTTTTATAGG - Intergenic
1167638945 19:50669602-50669624 CCAGCTCCAGCCACTTTTGCTGG - Intronic
926291923 2:11538411-11538433 CATATTCAAGTCACTTTTGCAGG + Intronic
927263479 2:21117906-21117928 CAAGGCCAGGACACTGTTTCTGG + Intergenic
928218488 2:29382438-29382460 TCAGGTCAAGAAATTTTTGCAGG + Intronic
929018429 2:37525485-37525507 CAAGGACAAGCCACCTTTCCAGG + Intergenic
929585580 2:43112192-43112214 CAAGCTCAAGACACTCCTGTGGG + Intergenic
930354714 2:50303358-50303380 CAATATCAAGACAGTTTGGCTGG + Intronic
932565939 2:72909384-72909406 CAATGTCAAGACACTTCAGTAGG - Intergenic
933969953 2:87462309-87462331 CAAAATTAAAACACTTTTGCAGG + Intergenic
934093154 2:88572324-88572346 TAAAGTCAAGATACTTCTGCTGG - Intronic
934991645 2:98925683-98925705 CAAAGTGAAGTCACTTTGGCAGG - Intronic
936962004 2:118085892-118085914 CAAAGTCAATAAACTTTTGTGGG + Intergenic
941423257 2:165310246-165310268 CAAGCTCATGATATTTTTGCCGG + Intronic
942508071 2:176665075-176665097 AAAAGTCAACACACTTTTTCTGG - Intergenic
942905609 2:181176927-181176949 CAAGGTTAAGACACTTTGAAAGG + Intergenic
942970349 2:181950703-181950725 CCAGGTCAACTCTCTTTTGCAGG - Intergenic
945088987 2:206160929-206160951 CAAGGTCGAGGCACATTGGCAGG - Intronic
945265407 2:207886414-207886436 CAAGGTGAAAACACCTTTCCAGG + Intronic
948169481 2:235889527-235889549 AAAGGCAAAGACACTTTTGGGGG - Intronic
1178774736 21:35539083-35539105 CAAGGGCAAGGCACTTCTGCAGG - Intronic
1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG + Intronic
1183340740 22:37279753-37279775 CCTGGTCAAGACACATTTACTGG + Intergenic
949517953 3:4824372-4824394 GAAGGTCGAGCAACTTTTGCAGG + Intronic
954176459 3:48849122-48849144 CAGGGTCAAGAAACTTGTCCAGG - Intergenic
955512160 3:59692121-59692143 GGAGGCCAAGACCCTTTTGCAGG - Intergenic
955552056 3:60095833-60095855 CCAAGTCAATAAACTTTTGCTGG - Intronic
963021129 3:140873988-140874010 CAAGGTCCAGGGACTGTTGCGGG + Intergenic
963905544 3:150770850-150770872 CAAGGTTATGTCAATTTTGCTGG - Intergenic
964917962 3:161858747-161858769 AAAGGTGAAGGGACTTTTGCAGG - Intergenic
965053627 3:163685291-163685313 CAAGTTCAAGACAGTTTTGTAGG - Intergenic
972390057 4:38605862-38605884 CAGGGTCAGGAGACTTTTGAGGG - Intergenic
974204584 4:58684368-58684390 CAAGTTCAAGACACTTTTGTAGG - Intergenic
975382976 4:73724035-73724057 GCAGGTCAAAACTCTTTTGCTGG - Intergenic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
976894830 4:90096893-90096915 CAAGTTCCAGACACTGTTGTAGG + Intergenic
981854748 4:149275024-149275046 CAAGATCAAGACACTTTTATAGG + Intergenic
984495053 4:180486537-180486559 CAAGGTCAAGACTATTTTTAAGG + Intergenic
986464732 5:8010015-8010037 CAAGGACAAGACTTTATTGCAGG - Intergenic
987919234 5:24257064-24257086 CATGGTCAAGAGAGTTTGGCTGG - Intergenic
988901358 5:35736097-35736119 CAAGATTAAGACACCTTTGTAGG + Intronic
994479941 5:100321941-100321963 CAATTTCAAGACACTGCTGCTGG - Intergenic
994851157 5:105057017-105057039 CAAGGGCAGGACACTTTTCCAGG - Intergenic
998928400 5:147153435-147153457 CAAGTTCAAGACACTTTTGTAGG - Intergenic
998941845 5:147292129-147292151 CAAGGTCAAAAAACTTGTGAGGG + Intronic
999819567 5:155212702-155212724 CAAGGTAAAGTAACTTGTGCAGG - Intergenic
1001041291 5:168337405-168337427 CAATGTCAAGACATTTCTGGTGG + Intronic
1002785164 6:394305-394327 CAAGTTGAAGACACATTTTCTGG - Intronic
1002864565 6:1109466-1109488 CAAGGTGAACAAACTTTTACTGG + Intergenic
1004262808 6:14123022-14123044 AAAGGTCAAGTCATTGTTGCTGG - Intronic
1007885260 6:45220763-45220785 CATGGGCAAGACACTGTTGGTGG + Intronic
1008526718 6:52414433-52414455 AAAGGTTAAGAAACTTCTGCAGG + Intergenic
1009965317 6:70571746-70571768 ACAGGTCTAGACAGTTTTGCAGG - Intronic
1013013520 6:106141400-106141422 AGAGGTCAAGCCACTTTTCCAGG + Intergenic
1013842811 6:114418474-114418496 CAAGCTCAAGACAGTACTGCAGG - Intergenic
1014623488 6:123698355-123698377 CTAGGTCAAAACATTTTTTCTGG + Intergenic
1016639787 6:146335640-146335662 AAAGTTCAAGACACTTTCCCAGG + Intronic
1023100929 7:36717453-36717475 GAAGGTGAACACACTTCTGCGGG + Intronic
1023289303 7:38652948-38652970 CAAGGTAAATACACATTAGCAGG - Intergenic
1026523493 7:71135554-71135576 GAAGATCAAGACACTGGTGCAGG - Intronic
1027296758 7:76781844-76781866 CAGGGTCAAAACAGTTTTTCTGG - Intergenic
1027952361 7:84833730-84833752 CATGGTAAACACACTTCTGCTGG - Intergenic
1028631719 7:92942374-92942396 CAAGCTCAAGACACTTTATCAGG + Intergenic
1031501326 7:122521453-122521475 CAAGATTAAGACTTTTTTGCGGG + Intronic
1033262719 7:139857662-139857684 GAAGGGCAAGACACTTTCCCAGG + Intronic
1034715212 7:153235487-153235509 CAAGGTTAGGACATTTTTACTGG - Intergenic
1037116453 8:15235389-15235411 CAAGGACAAGCTACTTTTGAGGG - Intronic
1037191647 8:16133192-16133214 CAAGTTCAAGACACTTTTATAGG + Intronic
1037279397 8:17219949-17219971 CCAGGTCATGACAATGTTGCTGG - Intronic
1037344341 8:17882074-17882096 CAAGATCAAGCAGCTTTTGCAGG - Exonic
1037626878 8:20615811-20615833 CAAGGTCTAGACTATTTTGAAGG + Intergenic
1038363586 8:26907964-26907986 CAAGACCAAGACACCTTTGTGGG - Intergenic
1039998139 8:42552828-42552850 CAAGGTCAAGTCACCATCGCTGG - Exonic
1040006102 8:42622214-42622236 CAACGTCAAGATTCTTTTGAGGG - Intergenic
1042818234 8:72901740-72901762 CAAGGTATATGCACTTTTGCTGG + Intronic
1045651735 8:104347844-104347866 CCATCTCAAGACACATTTGCAGG - Intronic
1048407828 8:134141118-134141140 CATTGTCAAGACACTTTTGGTGG + Intergenic
1053279966 9:36814022-36814044 CAAGGGGAAGAGACTTTTTCAGG + Intergenic
1056848725 9:90062810-90062832 CAAAGGCAAGACACTTTCCCTGG - Intergenic
1058689712 9:107509271-107509293 CAAGGTCAATATGCCTTTGCTGG + Intergenic
1058841175 9:108911052-108911074 CAAGGTCATTACTCTTTTGAGGG + Exonic
1062564787 9:137159373-137159395 CAGGGTCAAGAGACATTTGAGGG - Intronic
1186110673 X:6252619-6252641 TAAAGTCAAGAAACTTTTGGTGG + Intergenic
1186608274 X:11113481-11113503 CAAGGTCACAGAACTTTTGCTGG - Intronic
1189070620 X:37860129-37860151 CAAGGTAAATTCACTTTTGCTGG + Intronic
1196070222 X:111512614-111512636 CAAGTTCCAGACACTTTTTTAGG - Intergenic
1197478616 X:126953873-126953895 CCAGGTTCTGACACTTTTGCTGG + Intergenic
1197580947 X:128283110-128283132 CAAGGTCCTGATACTTTTACAGG + Intergenic
1198542664 X:137656716-137656738 CAAGGTGAAGACATTTTGGAAGG + Intergenic
1199604654 X:149567744-149567766 CAGAGTCAAGGGACTTTTGCAGG + Intergenic
1200737165 Y:6812381-6812403 CCAGGTGATGACACTGTTGCTGG + Intergenic
1200801178 Y:7388302-7388324 CAAGGTCCAGAGACTGTTGTGGG - Intergenic
1201777529 Y:17682716-17682738 CAGGTTCAAGACACTTTTTTTGG - Intergenic
1201824029 Y:18223276-18223298 CAGGTTCAAGACACTTTTTTTGG + Intergenic