ID: 1081469659

View in Genome Browser
Species Human (GRCh38)
Location 11:43358440-43358462
Sequence GGCTCGCATTATAGTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081469655_1081469659 3 Left 1081469655 11:43358414-43358436 CCCTCTATATTTTACATTCCACA No data
Right 1081469659 11:43358440-43358462 GGCTCGCATTATAGTGCTACTGG No data
1081469656_1081469659 2 Left 1081469656 11:43358415-43358437 CCTCTATATTTTACATTCCACAC No data
Right 1081469659 11:43358440-43358462 GGCTCGCATTATAGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081469659 Original CRISPR GGCTCGCATTATAGTGCTAC TGG Intergenic