ID: 1081475514

View in Genome Browser
Species Human (GRCh38)
Location 11:43426407-43426429
Sequence TATGGCCAATGCATGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081475514 Original CRISPR TATGGCCAATGCATGATCAA GGG (reversed) Intronic
901940006 1:12654821-12654843 TCTTGCCCATGAATGATCAAAGG - Intronic
903685976 1:25132299-25132321 TAGGGTCAATGCAGGATGAATGG - Intergenic
906491309 1:46270915-46270937 TATGGCCACTGAATAAACAAGGG + Intronic
909079884 1:71097373-71097395 TCTCCCCAATGCATGTTCAAGGG - Intergenic
910784624 1:90982988-90983010 TTTGGCAAATGCATGTTCAGTGG - Intronic
917880555 1:179331395-179331417 TATGCAAAATGCATGAGCAAGGG + Intronic
918646161 1:186907719-186907741 TTTGGCAAATGCATGATAATAGG + Intronic
919850505 1:201668959-201668981 TAGGGAAAATGCATGACCAATGG + Intronic
920954245 1:210602965-210602987 TATGGCGAAAGCATTTTCAAGGG + Intronic
921755247 1:218847741-218847763 TATGGAAAATGCATAAACAAAGG + Intergenic
924699133 1:246432894-246432916 TTTGGCCAAAGCAGGTTCAATGG + Intronic
1068824253 10:61415965-61415987 GATGGCCAATTCAGGCTCAAAGG + Intronic
1069592627 10:69651413-69651435 TTCGGCCAATGCTTGTTCAATGG - Intergenic
1072467784 10:95682542-95682564 TATGACAAATGCATTATCTATGG + Intronic
1076630301 10:131848368-131848390 TCTGGCCAATGCATGGTCAGGGG + Intergenic
1077741314 11:4848807-4848829 GATGGCCAGTGCCCGATCAATGG + Exonic
1078103284 11:8342868-8342890 CATGGCCACTGCAGGATCAAAGG + Intergenic
1080125606 11:28729762-28729784 TATGCCCAATGTATGTTAAAGGG + Intergenic
1081475514 11:43426407-43426429 TATGGCCAATGCATGATCAAGGG - Intronic
1089855145 11:121537083-121537105 AAGGGCCAAAGCATGATCAGTGG + Intronic
1091346437 11:134857293-134857315 GGAGGCCAATGCATGACCAATGG + Intergenic
1092498492 12:9022601-9022623 TAAGACCAAGGCATGATCAGAGG + Intergenic
1098312912 12:69165364-69165386 TGTGAGCAATGCATGAGCAATGG - Intergenic
1100206736 12:92357959-92357981 TCTGGCCAATGAAATATCAAAGG - Intergenic
1101169144 12:102070435-102070457 TATGCCCAATGCATGCAAAAGGG + Intergenic
1101311574 12:103585499-103585521 CATGGCCAATCCATGAGAAAGGG + Intergenic
1103706491 12:122876911-122876933 TGTGGCCAATGCTGGGTCAAGGG + Intronic
1107397705 13:40034589-40034611 TGTGGGCAATGCATGTTCACTGG + Intergenic
1108794464 13:54014568-54014590 TATTACCAATGAATGATGAAAGG + Intergenic
1109474606 13:62862923-62862945 TCTGGCCCCTTCATGATCAAAGG - Intergenic
1110413806 13:75230750-75230772 TATTCCCAATGCTTGATCCATGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1114563324 14:23609299-23609321 TCTGGCCAATGCATAAACAAAGG - Intergenic
1115258079 14:31423557-31423579 TATGGGCTAGGCATGATCACAGG - Intronic
1118894194 14:69932113-69932135 TATGGTGAAGGCATGCTCAAGGG + Intronic
1120268320 14:82278376-82278398 CATGGCCAAAGCAGGATCAAGGG - Intergenic
1122518681 14:102327100-102327122 TATGGCCACAGCAGGAACAAGGG + Intronic
1122822116 14:104352979-104353001 TAAGGCCAGTGCAGGCTCAACGG + Intergenic
1126696120 15:51327178-51327200 TAAGGCCAATGGGTGATCCATGG + Intronic
1127847670 15:62885698-62885720 TCTGGCAAATGAATGCTCAAAGG - Intergenic
1131854910 15:96583451-96583473 TAAGGCAAATGCATGACAAATGG - Intergenic
1131915130 15:97256898-97256920 TATCTCCAATGCATTAACAACGG - Intergenic
1132946784 16:2536221-2536243 TATGGCCAATGGATGACCTCAGG - Intergenic
1136341905 16:29649609-29649631 CATCGCAAATGCCTGATCAAGGG - Intergenic
1138158182 16:54725762-54725784 TATGGCCATTGCATCACCAATGG + Intergenic
1144266200 17:13572316-13572338 TATGGCAGGTGCAGGATCAAAGG + Intronic
1147944760 17:44074688-44074710 TCTGGACACTGCATGATCACAGG + Exonic
1155354449 18:24937797-24937819 TTTGGCCAATGCCAGATGAAGGG - Intergenic
1157743299 18:50112546-50112568 CATGCACAATGCATGCTCAAAGG - Intronic
1165706760 19:37981825-37981847 TATGGCCAATGACTCATAAAGGG - Intronic
1167012658 19:46819122-46819144 TAAGGCCAATTCATGATGACTGG - Intergenic
925318992 2:2947371-2947393 TATGGCCAATGGATGAATACAGG + Intergenic
928430594 2:31215358-31215380 TATGGCAAATGCAGGATCAGAGG - Intronic
928790223 2:34941138-34941160 TATGGCCTATATATGATCTATGG - Intergenic
933190947 2:79332696-79332718 TAACGCCAATCCCTGATCAAGGG - Intronic
934322478 2:91982116-91982138 TAAGGCCAGGGCAGGATCAAAGG - Intergenic
939049517 2:137291110-137291132 TATGGGTAATGCCTGGTCAATGG - Intronic
939441872 2:142260528-142260550 TATGGCCAGAGCTTGAGCAAGGG - Intergenic
941015592 2:160352241-160352263 TATGTGCAATGCACGGTCAAGGG + Intronic
945236403 2:207635749-207635771 TATTGCCAATGCATGCTCCAGGG + Intergenic
945412091 2:209522284-209522306 TATGGCTAATGCAAAACCAATGG + Intronic
947643758 2:231722702-231722724 TTTGGGAAATCCATGATCAAAGG + Intergenic
1168985929 20:2049216-2049238 GATGGCCACTGCATGCTCTAGGG - Intergenic
1170621688 20:18001733-18001755 TGTGGCCAAGGCAAGACCAAAGG + Intronic
1172115579 20:32571716-32571738 TGTGGCCAGTGCATGATCTTGGG - Intronic
1174432040 20:50477363-50477385 AATGGCCAATGCATGATAAGTGG + Intergenic
1174911290 20:54610692-54610714 TATGGCCAAGGTATTACCAACGG - Intronic
1175148640 20:56915620-56915642 CATGGTCAATGCATCACCAATGG + Intergenic
1178392259 21:32208423-32208445 TATGGCCAAAGCAGAAGCAAGGG - Intergenic
1180549229 22:16528020-16528042 TAAGGCCAGGGCAGGATCAAAGG - Intergenic
1183150832 22:36036176-36036198 TCTGGCCCATGAATTATCAAGGG - Intergenic
952705560 3:36373970-36373992 TATGGGCAATGCTTGAAAAAAGG - Intergenic
953323553 3:41993332-41993354 TAAGGCCAATGAGTTATCAATGG - Intergenic
955148357 3:56342430-56342452 TATGGCAAATGTCTGATGAATGG - Intronic
956617675 3:71189300-71189322 TAAGCCCATTCCATGATCAATGG + Intronic
961612111 3:128148176-128148198 TTTGGCCAATGCATGATATCAGG - Intronic
962369130 3:134806178-134806200 TAAGGCCAATCCATATTCAAAGG - Intronic
964571540 3:158112193-158112215 TAAGGGCAATGAATGATGAATGG - Intronic
970548034 4:17149391-17149413 TCTGGCCAATGAAGGATGAATGG - Intergenic
970795878 4:19912861-19912883 TAAGTCCAATGTCTGATCAATGG + Intergenic
972294465 4:37723283-37723305 AATGGCAACTGCATGTTCAAAGG - Intergenic
974795049 4:66738162-66738184 TATGGCCAATGCTTTTACAATGG + Intergenic
974911252 4:68123661-68123683 TATGGAAAATGAATGATAAAAGG + Intronic
977650853 4:99467655-99467677 TATGGAAAATGTATGATTAATGG - Intergenic
983695589 4:170525770-170525792 TATGGCCAATTGATTTTCAACGG + Intergenic
986063565 5:4214135-4214157 TAAGGCCACTGCCTGAGCAATGG - Intergenic
986349533 5:6865007-6865029 TATCAACAATGCATGACCAATGG + Intergenic
989758026 5:44979921-44979943 TATGGCCAATCCATGGACATGGG - Intergenic
990832572 5:59976147-59976169 TATGACTAATGCATGATTGAGGG + Intronic
997100694 5:130965713-130965735 TATGGCCAATGCAGAATAAGTGG + Intergenic
997541044 5:134662649-134662671 CAGGGCCAATGTCTGATCAAAGG - Intronic
1003510075 6:6772321-6772343 GATGGCCAATGCATGAGTACAGG + Intergenic
1007955268 6:45912281-45912303 GATGGCCAATGAAAGAACAAAGG - Intronic
1008436987 6:51487380-51487402 TGTGTGCAATGCATGATAAAAGG - Intergenic
1011993605 6:93555871-93555893 TATGTACAATGGATTATCAAAGG - Intergenic
1015334581 6:132022627-132022649 TAGGTCCAAGGCATGACCAAAGG + Intergenic
1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG + Intergenic
1021956974 7:25834971-25834993 TATGGCCAAACCCAGATCAAAGG - Intergenic
1026337013 7:69403124-69403146 AATCGCCACTGCATGAACAAGGG + Intergenic
1028257183 7:88613584-88613606 TATGGCCAAAGCAGGAAGAAGGG + Intergenic
1039048787 8:33474031-33474053 TTTGGGTAATGCATGAACAACGG - Intronic
1043757821 8:84026018-84026040 TATTGCCAAGGAATGCTCAAAGG + Intergenic
1045690065 8:104751257-104751279 TATGGCCAAGGCCTTATCATTGG + Intronic
1047102384 8:121692364-121692386 TATTTCCAATCCATGAGCAAAGG - Intergenic
1047200841 8:122765248-122765270 TATGGTGTATACATGATCAAGGG + Intergenic
1048115232 8:131514231-131514253 TATGGCAAAAGCAGGAGCAAGGG - Intergenic
1048681121 8:136842866-136842888 TCTGGCCCCTGCATGATCACTGG + Intergenic
1049173872 8:141179562-141179584 TATGGCCAACTCATGATGGAAGG + Intronic
1052587244 9:30444592-30444614 TATGGCCCATGCAATATAAAGGG - Intergenic
1054984165 9:71242768-71242790 TATGGAGAATGGATGATGAAAGG - Intronic
1058152722 9:101479964-101479986 TTTGGCCAATGAATGATGAGTGG - Intronic
1059403276 9:114084017-114084039 TATGTCCAATGAATGAGCAAAGG + Intergenic
1186210787 X:7248550-7248572 TAAGGCCAATGCAGGATACATGG + Intronic
1188108601 X:26170868-26170890 TATGGCCAGGGCATGTTCCAGGG + Intergenic
1188245654 X:27833165-27833187 TGTGGCCAATGCACGTTCCAAGG + Intergenic
1192083682 X:68072894-68072916 TAAGGCCAGTGCAGGATCCAAGG - Intronic
1194967292 X:100303134-100303156 TATGGCAAATGTATTTTCAACGG - Intronic
1195871830 X:109494370-109494392 CATAGCTATTGCATGATCAAAGG + Intergenic
1198208069 X:134487825-134487847 TATGGACAAAGCATGCTGAAAGG - Intronic