ID: 1081480247

View in Genome Browser
Species Human (GRCh38)
Location 11:43479702-43479724
Sequence AGAATTGATGACGTTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081480247 Original CRISPR AGAATTGATGACGTTGTAGA GGG Intronic
909658543 1:78057160-78057182 AGAACTGATGACATTTTAAAAGG - Intronic
910132219 1:83921731-83921753 AGTATTGCTGACATTTTAGACGG - Intronic
910304299 1:85744225-85744247 AGAATTGATGACCATGAAGATGG - Intronic
911209523 1:95124781-95124803 AGAAATGAGGAAGTTTTAGATGG + Intronic
913391963 1:118324037-118324059 AGAATTAATGACCTTGGATATGG - Intergenic
914926677 1:151894720-151894742 AGAGGTGATGAGGTTGTAGGAGG + Intronic
917436035 1:175022626-175022648 AAAATTGATGATGTAGAAGAGGG - Intronic
917879117 1:179316198-179316220 AGAATTGATGACTGGGAAGAAGG - Intronic
1065206371 10:23361371-23361393 AGAATTGATGACTTTCTAGAAGG - Intergenic
1072911875 10:99509369-99509391 AGAATTGATGTGGTTGTGCATGG - Intergenic
1079328586 11:19515125-19515147 AGAATGGATGGAGTGGTAGAGGG + Intronic
1079687010 11:23371735-23371757 AGAATTAATGAACTTGAAGATGG + Intergenic
1081480247 11:43479702-43479724 AGAATTGATGACGTTGTAGAGGG + Intronic
1086410864 11:86542526-86542548 AGAATTGATTAAGCGGTAGAAGG + Intronic
1086823048 11:91459567-91459589 AGATTTGATGGTTTTGTAGAGGG - Intergenic
1087317708 11:96623512-96623534 AGAATAGATGAAGAAGTAGACGG + Intergenic
1091119263 11:133043132-133043154 AGAGTTGATGAGGTGGAAGATGG - Intronic
1092052810 12:5484569-5484591 AGCATTGATTACATTGTAAAAGG + Intronic
1093099675 12:15012734-15012756 AGAATTGATGATGTTACAGATGG + Intergenic
1093647312 12:21601734-21601756 AGAATTGACAAATTTGTAGAAGG - Intronic
1094225027 12:28035150-28035172 TGAATTGATGACGGTGCAGAGGG - Intergenic
1094741775 12:33297358-33297380 AGAATTAATGAGCTTGAAGACGG + Intergenic
1096823538 12:54256394-54256416 AGAATTATTGGCGTTGTAGGTGG - Intronic
1097162709 12:57060039-57060061 AGATTTGCTGACTTTGTGGAAGG - Exonic
1102435384 12:112918863-112918885 GGGATTGATGATGTTGCAGATGG + Intronic
1103182181 12:118922859-118922881 AGAATTAATGATCTGGTAGAAGG - Intergenic
1103241234 12:119414918-119414940 AGAATAGATGAAGTTGTTCAAGG - Intronic
1108279857 13:48850592-48850614 AGCCTTGATGATTTTGTAGAAGG - Intergenic
1112874007 13:104013071-104013093 ATTATTAATGACGTTTTAGAAGG + Intergenic
1112905034 13:104407277-104407299 AGAATTGGTGACCTAGAAGATGG + Intergenic
1118145212 14:63127293-63127315 AGACTTGATGATTTTCTAGAAGG - Intergenic
1118145652 14:63132558-63132580 AAAATTGATGAAATTGAAGAAGG + Intergenic
1119271400 14:73308197-73308219 AGAATTGATTAGGTTCTTGAAGG + Intronic
1120462350 14:84813361-84813383 AGAATTCATGACCTTTTTGAAGG - Intergenic
1127103029 15:55587421-55587443 AGAGTTGATGCTGTTGAAGAAGG - Intronic
1130346565 15:83052537-83052559 AGACTAGATGCCGTAGTAGAAGG - Intronic
1132243582 15:100278395-100278417 AGAGTTGATGACTTTGAAGGAGG + Intronic
1135102613 16:19619818-19619840 AGAATTGATGTCGGTATGGAAGG + Intronic
1137495222 16:48964294-48964316 AGAATTCATGACCTTGGAGGAGG - Intergenic
1138225237 16:55289152-55289174 ATAATTGCTGAAGCTGTAGATGG + Intergenic
1140287740 16:73620569-73620591 AGAATTGATGCAGTTTAAGATGG + Intergenic
1142626114 17:1193114-1193136 AGAATGGATGACTGTGGAGAAGG + Intronic
1144525333 17:15984554-15984576 TGAATGGATGACCATGTAGATGG - Intronic
1144658665 17:17054367-17054389 AGACTTGATGACTTTTTAGTAGG + Intronic
1146398299 17:32485993-32486015 AGAATTGAAAACGTTTAAGAGGG + Intergenic
1156917807 18:42482323-42482345 AGAATTGATGTCTTTTTATAAGG + Intergenic
1166174555 19:41057548-41057570 GGAACTGATGACGTTGGAAACGG + Intergenic
1168638853 19:58017360-58017382 AGGATGGATGACACTGTAGATGG + Intergenic
932030463 2:68178428-68178450 AGAATAAATGCCATTGTAGAAGG + Intronic
932042648 2:68317676-68317698 AGAATTTCTGATGGTGTAGAAGG - Intronic
932966070 2:76475947-76475969 AGATTTGAAGAAGTTGTGGAAGG + Intergenic
941624122 2:167811556-167811578 AGATTTGTTGAAGTTGTACATGG - Intergenic
946086281 2:217176442-217176464 AGAGTTGAGGAAGCTGTAGATGG - Intergenic
948926400 2:241101523-241101545 ACAATCGATGACGCTGGAGAAGG - Intronic
1169089472 20:2849746-2849768 AGTAATGATGACTTTATAGATGG - Intronic
1169663284 20:8005434-8005456 AGTTTTGATGACATTGGAGATGG + Intronic
1169797315 20:9477443-9477465 AGTATTGACCACGGTGTAGAAGG - Intronic
1170129579 20:13004555-13004577 AGCATTGCTGACTTTGAAGATGG + Intergenic
1171177508 20:23063843-23063865 AGTATTTAGGAAGTTGTAGAAGG + Intergenic
1179238495 21:39567914-39567936 AGAAATGATGATGTAGGAGAGGG - Intronic
1182879706 22:33722919-33722941 TGTTTTGATGACGTTGTAAAGGG + Intronic
1184030542 22:41891891-41891913 AGAACTGAAAACGTGGTAGATGG + Intronic
949401398 3:3668688-3668710 ATCATTGATGACTTTGAAGAAGG - Intergenic
951145499 3:19221632-19221654 AGAATTGATAAGGCTGTAGAAGG - Intronic
954084078 3:48230331-48230353 AGCATTGATAAAGTTGTGGAGGG + Intergenic
957355358 3:79076819-79076841 TTAATAGATAACGTTGTAGAGGG + Intronic
958926320 3:100161533-100161555 AGAAATGAGGATATTGTAGAAGG + Intronic
963603652 3:147396878-147396900 AGAAATGATGATGTTGGAGGTGG + Intronic
965904826 3:173690951-173690973 AAAATTGCAGAAGTTGTAGAAGG + Intronic
971996641 4:33973938-33973960 AGAATCCATGACGTTGGAAAAGG + Intergenic
974420946 4:61672675-61672697 AGTGTTGATGACAATGTAGAGGG + Intronic
975941082 4:79646989-79647011 ATAAATGATGACCTTATAGAAGG - Intergenic
975942270 4:79661399-79661421 AGATCTGATGACTTTATAGATGG + Intergenic
979503708 4:121468950-121468972 AGAATTGCTGGCTTTGAAGATGG - Intergenic
981981337 4:150794833-150794855 AGAATAGATGACCTGGCAGAAGG + Intronic
984667601 4:182445860-182445882 AGAATTGCTTAAGTTATAGAAGG + Intronic
985045130 4:185932888-185932910 AGAACTGAAAACATTGTAGAAGG - Intronic
988549833 5:32190387-32190409 AGAATTCATTTCCTTGTAGAGGG + Intergenic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990700351 5:58468221-58468243 AGAATTGTTGACTTTGGAGGTGG - Intergenic
991287618 5:64996164-64996186 AGAATTGACAAAGTTGCAGAAGG + Intronic
991310150 5:65229698-65229720 AGAATTTATGAACTTGAAGAGGG + Intronic
992589882 5:78283567-78283589 TTAATTGATGACATTGTAGTTGG - Intronic
993362094 5:86990147-86990169 ATAATTGATGACATTTTAGCTGG - Intergenic
994967366 5:106691596-106691618 AGAAGTGGTTATGTTGTAGAAGG + Intergenic
998707090 5:144775017-144775039 AGACTTGTTCAAGTTGTAGAGGG + Intergenic
999914492 5:156242749-156242771 AGAATTGAGGAAGCTGTGGAGGG + Intronic
1002198198 5:177512524-177512546 ATAATTGATGACGTGCTGGATGG + Exonic
1007523442 6:42469839-42469861 AGAGTTCATGACCTTGAAGAAGG - Intergenic
1008930090 6:56930302-56930324 AGAATTAATGACTTCGAAGAAGG + Intronic
1010462824 6:76132670-76132692 AGTAGTGATGACTATGTAGATGG + Intergenic
1011341687 6:86322533-86322555 AGATTTGATAAAGTTTTAGAAGG + Intergenic
1011949125 6:92942524-92942546 AGAATGCATGATGTTGTAGCTGG - Intergenic
1012434225 6:99197834-99197856 AGGATTGATGCCTTTATAGAAGG - Intergenic
1012966336 6:105678022-105678044 AGAGTTGAAGAGGTTGGAGAAGG - Intergenic
1013626543 6:111943119-111943141 AGAGTTGAGGACACTGTAGATGG - Intergenic
1014587293 6:123214802-123214824 TGAATTGATGATATTGCAGAGGG + Intergenic
1017291837 6:152746053-152746075 AGAATAGATGTAGTGGTAGAGGG + Intergenic
1021085696 7:16419752-16419774 CGAATTGATGAGTTTGGAGATGG - Intronic
1024190069 7:46997106-46997128 TGGATTAATGAGGTTGTAGAAGG - Intergenic
1025620548 7:63166294-63166316 AGAGTTGATGAGGTGGTACAGGG - Intergenic
1028089379 7:86679211-86679233 AGATGTGATGAATTTGTAGAAGG + Intronic
1029980991 7:104879033-104879055 AGAGGTGAGGAAGTTGTAGAAGG + Intronic
1030237895 7:107286723-107286745 AGAATAGATGAAGTTGTAAGAGG - Intronic
1032615437 7:133464569-133464591 AGAGTTGGTGACCTTATAGATGG + Intronic
1033093221 7:138405899-138405921 AGAGTGGAGCACGTTGTAGATGG - Intergenic
1033176179 7:139125900-139125922 AGACTAAATGACGTTGGAGACGG + Intergenic
1038247000 8:25867616-25867638 AGAATTGATGAAGTTGCCCAGGG - Intronic
1038510309 8:28128125-28128147 AAAATTGAGAACATTGTAGAAGG + Intronic
1041786262 8:61637673-61637695 ACAATTGATGAGGGTGTGGAGGG - Intronic
1043050578 8:75380425-75380447 AGAACTGATGACATTATAAAAGG + Intergenic
1043242207 8:77948727-77948749 AGAATTGGTGACTTAGTACAGGG - Intergenic
1044523758 8:93228769-93228791 AGAATTGATTACCTTGAAAATGG + Intergenic
1048392776 8:133984013-133984035 AGAGTTGAAGAAATTGTAGATGG - Intergenic
1050107778 9:2183351-2183373 AGAATTGTTGACTGTGGAGAAGG - Intronic
1055209344 9:73770595-73770617 AAAATTGAAGAGGTTGAAGAAGG - Intergenic
1057029751 9:91766511-91766533 AGAATCGATGACGTTGAAAATGG - Intronic
1057485066 9:95476333-95476355 AGAATTGATGACTCTGTAGATGG - Intronic
1058734760 9:107884023-107884045 AGAATTAATGACTTTATGGAGGG + Intergenic
1059804584 9:117784888-117784910 AGGAATGATGAGGTGGTAGAGGG - Intergenic
1186960160 X:14727882-14727904 ACAATTGATGAAGTTGGACAAGG - Intronic
1187007036 X:15242230-15242252 AGAATTTATGAGGTTGTACCAGG + Intronic
1187936382 X:24340204-24340226 AGTGTTGATGAGGTTGTGGAGGG + Intergenic
1190796173 X:53745075-53745097 AGAATTTATGACCTTGGAGCAGG - Intergenic
1192853566 X:74983117-74983139 AGAATTGATGAAGCAGAAGAAGG + Intergenic
1198058824 X:133022816-133022838 AAAATTGCTGACTTTGAAGATGG + Intergenic
1198863649 X:141097149-141097171 ATAATTGATGTAGTTGTTGAGGG - Intergenic
1198899038 X:141490228-141490250 ATAATTGATGTAGTTGTTGAGGG + Intergenic