ID: 1081480438

View in Genome Browser
Species Human (GRCh38)
Location 11:43482147-43482169
Sequence AAGAGAAAACAAAAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4197
Summary {0: 1, 1: 0, 2: 20, 3: 363, 4: 3813}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081480438_1081480440 30 Left 1081480438 11:43482147-43482169 CCACCATCTTTTTGTTTTCTCTT 0: 1
1: 0
2: 20
3: 363
4: 3813
Right 1081480440 11:43482200-43482222 TCCTTGTCTTCCGCTTGCTTAGG 0: 1
1: 2
2: 22
3: 543
4: 1374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081480438 Original CRISPR AAGAGAAAACAAAAAGATGG TGG (reversed) Intronic
Too many off-targets to display for this crispr