ID: 1081483787

View in Genome Browser
Species Human (GRCh38)
Location 11:43512160-43512182
Sequence GTACTGGGAGGTGAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483787_1081483794 -9 Left 1081483787 11:43512160-43512182 CCCTCTCCCTCACCTCCCAGTAC No data
Right 1081483794 11:43512174-43512196 TCCCAGTACCTCCAAGGCCAGGG No data
1081483787_1081483801 20 Left 1081483787 11:43512160-43512182 CCCTCTCCCTCACCTCCCAGTAC No data
Right 1081483801 11:43512203-43512225 TCTAGCCATCGTTGAGTCCATGG No data
1081483787_1081483797 -5 Left 1081483787 11:43512160-43512182 CCCTCTCCCTCACCTCCCAGTAC No data
Right 1081483797 11:43512178-43512200 AGTACCTCCAAGGCCAGGGCTGG No data
1081483787_1081483803 27 Left 1081483787 11:43512160-43512182 CCCTCTCCCTCACCTCCCAGTAC No data
Right 1081483803 11:43512210-43512232 ATCGTTGAGTCCATGGTGCCCGG No data
1081483787_1081483793 -10 Left 1081483787 11:43512160-43512182 CCCTCTCCCTCACCTCCCAGTAC No data
Right 1081483793 11:43512173-43512195 CTCCCAGTACCTCCAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483787 Original CRISPR GTACTGGGAGGTGAGGGAGA GGG (reversed) Intergenic