ID: 1081483788

View in Genome Browser
Species Human (GRCh38)
Location 11:43512161-43512183
Sequence GGTACTGGGAGGTGAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483788_1081483794 -10 Left 1081483788 11:43512161-43512183 CCTCTCCCTCACCTCCCAGTACC No data
Right 1081483794 11:43512174-43512196 TCCCAGTACCTCCAAGGCCAGGG No data
1081483788_1081483797 -6 Left 1081483788 11:43512161-43512183 CCTCTCCCTCACCTCCCAGTACC No data
Right 1081483797 11:43512178-43512200 AGTACCTCCAAGGCCAGGGCTGG No data
1081483788_1081483801 19 Left 1081483788 11:43512161-43512183 CCTCTCCCTCACCTCCCAGTACC No data
Right 1081483801 11:43512203-43512225 TCTAGCCATCGTTGAGTCCATGG No data
1081483788_1081483803 26 Left 1081483788 11:43512161-43512183 CCTCTCCCTCACCTCCCAGTACC No data
Right 1081483803 11:43512210-43512232 ATCGTTGAGTCCATGGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483788 Original CRISPR GGTACTGGGAGGTGAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr