ID: 1081483790

View in Genome Browser
Species Human (GRCh38)
Location 11:43512167-43512189
Sequence CTTGGAGGTACTGGGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483790_1081483801 13 Left 1081483790 11:43512167-43512189 CCTCACCTCCCAGTACCTCCAAG No data
Right 1081483801 11:43512203-43512225 TCTAGCCATCGTTGAGTCCATGG No data
1081483790_1081483804 25 Left 1081483790 11:43512167-43512189 CCTCACCTCCCAGTACCTCCAAG No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483790_1081483803 20 Left 1081483790 11:43512167-43512189 CCTCACCTCCCAGTACCTCCAAG No data
Right 1081483803 11:43512210-43512232 ATCGTTGAGTCCATGGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483790 Original CRISPR CTTGGAGGTACTGGGAGGTG AGG (reversed) Intergenic