ID: 1081483791 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:43512168-43512190 |
| Sequence | CTCACCTCCCAGTACCTCCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1081483786_1081483791 | 25 | Left | 1081483786 | 11:43512120-43512142 | CCTGTCACGTGGCTGTAACAATG | No data | ||
| Right | 1081483791 | 11:43512168-43512190 | CTCACCTCCCAGTACCTCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1081483791 | Original CRISPR | CTCACCTCCCAGTACCTCCA AGG | Intergenic | ||